Rabbit calicivirus capsid Taqman RT-qPCR
Robyn Hall, Lily Tran, Nina Huang, Ina Smith, Tanja Strive
Abstract
To improve the sensitivity and throughput of molecular testing for rabbit caliciviruses we have developed a multiplex TaqMan RT-qPCR assay that detects the three different pathogenic rabbit calicivirus capsid genotypes currently circulating in Australia. Target sequences for all three variants (GI.1c, GI.2, GI.1a) are located within the VP60 capsid sequence. This will also detect subgenomic RNAs, increasing the sensitivity of the method when compared to assays targeting the non-structural gene sequences. Currently this assay is designed to be run as a one-step RT-qPCR assay for high throughput, rapid diagnostic purposes. It has not been designed for quantification of virus loads. For that purpose, the universal lagovirus SYBR-green assay is still recommended (Hall et al, 2018). This assay has not been designed for the detection of recombinant viruses, and will only return the capsid variant/s present in a sample.
Before start
Prepare RNA samples for testing. All runs should include a 'no template control' and positive control samples of a GI.1c, GI.1a, and GI.2 RHDV (or a pooled positive control at a minimum).
Steps
Plate set-up
| A | B | C | D | E | F | G | H | I | J | K | L |
|---|---|---|---|---|---|---|---|---|---|---|---|
| GI.1 | GI.1 | RNA 6 | RNA 6 | RNA 15 | RNA 15 | RNA 24 | RNA 24 | RNA 33 | RNA 33 | RNA 41 | RNA 41 |
| GI.2 | GI.2 | RNA 7 | RNA 7 | RNA 16 | RNA 16 | RNA 25 | RNA 25 | RNA 34 | RNA 34 | RNA 42 | RNA 42 |
| GI.1a | GI.1a | RNA 8 | RNA 8 | RNA 17 | RNA 17 | RNA 26 | RNA 26 | RNA 35 | RNA 35 | RNA 43 | RNA 43 |
| NTC | NTC | RNA 9 | RNA 9 | RNA 18 | RNA 18 | RNA 27 | RNA 27 | RNA 36 | RNA 36 | RNA 44 | RNA 44 |
| RNA 1 | RNA 1 | RNA 10 | RNA 10 | RNA 19 | RNA 19 | RNA 28 | RNA 28 | RNA 37 | RNA 37 | RNA 45 | RNA 45 |
| RNA 2 | RNA 2 | RNA 11 | RNA 11 | RNA 20 | RNA 20 | RNA 29 | RNA 29 | RNA 38 | RNA 38 | RNA 46 | RNA 46 |
| RNA 3 | RNA 3 | RNA 12 | RNA 12 | RNA 21 | RNA 21 | RNA 30 | RNA 30 | RNA 39 | RNA 39 | RNA 47 | RNA 47 |
| RNA 4 | RNA 4 | RNA 13 | RNA 13 | RNA 22 | RNA 22 | RNA 31 | RNA 31 | RNA 40 | RNA 40 | RNA 48 | RNA 48 |
| RNA 5 | RNA 5 | RNA 14 | RNA 14 | RNA 23 | RNA 23 | RNA 32 | RNA 32 | RNA 41 | RNA 41 | RNA 49 | RNA 49 |
Plate layout for rabbit calicivirus capsid Taqman RT-qPCR. Samples and controls are routinely run in duplicate. We run individual controls for each strain; at a minimum a pooled positive control should be run.
Reaction set-up
In a dedicated Mastermix hood, UV a 96 well qPCR plate and a Microseal B film for 30 minutes prior to use.* Thaw reagents during this time.
- Prepare a 10 µM primer mix of GI.1 fwd; GI.1c_rev; GI.2 fwd; GI.2 rv; GI.1a fwd; GI.1a rv. Combine 10 µl of each primer stock (at 100 µM) with 40 µl of nuclease-free water.
- Prepare a Mastermix for number of required reactions + 7% extra to account for pipetting inaccuracies:
| A | B |
|---|---|
| µl per reaction | |
| Nuclease-free H2O | 5 |
| SensiFAST Probe No-ROX One-Step Mix (2x) | 7.5 |
| 10µM primer mix | 0.6 |
| 10µM GI.1c probe | 0.15 |
| 10µM GI.2 probe | 0.15 |
| 10µM GI.1a probe | 0.15 |
| RiboSafe RNase Inhibitor | 0.15 |
| Reverse transcriptase | 0.3 |
| Template RNA | 1 |
| TOTAL REACTION VOLUME | 15 µl |
Preparation of Mastermix. Include 7% extra to account for pipetting inaccuracies.
| A | B | C |
|---|---|---|
| Name | Sequence (5' - 3') | Ref |
| GI.1 fwd | TTCAGTTYTGGTAYGCCAATGCTG | This study |
| GI.1c_rev | AGGCCTGCACAGTCGTAACGTT | Hall et al, 2018 |
| GI.1c probe | FAM - ATGTCGTTCGTACCCTTTAACGGCCCTG - BHQ1 | This study |
| GI.2 fwd | TGGAACTTGGCTTGAGTGTTGA | Duarte et al, 2015 |
| GI.2 rv | ACGAGCGTGCTTGTGGACGG | Duarte et al, 2015 |
| GI.2 probe | HEX - TGTCAGAACTTGTTGAYATYCGCCC - BHQ1 | Duarte et al, 2015 |
| GI.1a fwd | AGTGCAAGTTWTKCTGGGAACAACT | This study |
| GI.1a rv | AAGCCTGYACAGTCGTAGCAGC | This study |
| GI.1a probe | TexasRed - ATGTCATTCGTGCCYTTTAACAGCCCCA - BHQ2 | This study |
Primer and probe sets for rabbit calicivirus capsid TaqMan RT-qPCR
-
Distribute 14 µl of Mastermix to each well of 96 well PCR plate.
-
Add 1 µl of template to respective wells (in duplicate). - Ideally, this is done in a dedicated template addition area
-
Seal plate with Microseal B film.
-
Briefly spin plate down.
-
Place plate in qPCR thermocycler (BioRad CFX96) and commence run.
| A | B | C |
|---|---|---|
| Temperature (°C) | Duration | |
| Reverse transcription | 45 | 10 min |
| Initial denaturation | 95 | 2 min |
| 40 cycles of: | 95 | 5 sec |
| 63 | 20 sec |
Thermocycling conditions for rabbit calicivirus capsid TaqMan RT-qPCR
Analysis
Set baseline to 100 RFU for each fluorophore* Quality control:
- No amplification in any channel in NTCs.
- FAM positive for GI.1 control only (or pooled positive if run).
- HEX positive for GI.2 control only (or pooled positive if run).
- TexasRed positive for GI.1a control only (or pooled positive if run).
- Cq of positive controls within 0.5 Cq of previous runs.
- Cq standard deviation <0.5 between replicates.
